Home
World Journal of Advanced Research and Reviews
International Journal with High Impact Factor for fast publication of Research and Review articles

Main navigation

  • Home
    • Journal Information
    • Editorial Board Members
    • Reviewer Panel
    • Abstracting and Indexing
    • Journal Policies
    • Our CrossMark Policy
    • Publication Ethics
    • Issue in Progress
    • Current Issue
    • Past Issues
    • Instructions for Authors
    • Article processing fee
    • Track Manuscript Status
    • Get Publication Certificate
    • Join Editorial Board
    • Join Reviewer Panel
  • Contact us
  • Downloads

eISSN: 2581-9615 || CODEN: WJARAI || Impact Factor 8.2 ||  CrossRef DOI

Research and review articles are invited for publication in March 2026 (Volume 29, Issue 3) Submit manuscript

Evaluation of protamine 2 genes in spermatozoa of teratospermic and oligospermic men in Nigeria

Breadcrumb

  • Home
  • Evaluation of protamine 2 genes in spermatozoa of teratospermic and oligospermic men in Nigeria

Emmanuel Sunday Oni 1, *, Ojo Moses Oke 1, Josephine Kpalap 2, Samuel Kehinde Wojuade 4, Adewale Oke 3 and Emmanuel Ayomide Oni 1

1 Department of Medical Laboratory Science, Joseph Ayo Babalola University, Ikeji-Arakeji, Osun State, Nigeria.
2 Department of Medical Laboratory Science, Rivers State University Port-Harcourt, Nigeria.
3 Department of Medical Laboratory Science, McPherson University, Lagos Ibadan Express way, Ibadan, Nigeria.
4 Abims Fertility and Andrology Clinic 25, Olowu Street, Off Awolowo way, Ikeja, Lagos.
 
Research Article
World Journal of Advanced Research and Reviews, 2024, 23(01), 2235-2242
Article DOI: 10.30574/wjarr.2024.23.1.2164
DOI url: https://doi.org/10.30574/wjarr.2024.23.1.2164
 
Received on 08 June 2024; revised on 20 July 2024; accepted on 22 July 2024
 
There have been several reports of single nucleotide polymorphisms (SNPs) linked to different kinds of male infertility. The aim of the study was to evaluate single nucleotide polymorphisms in protamine 2 gene (PRM2) in spermatozoa of teratospermic and oligospermic infertile men in Nigeria. At some fertility clinics in Lagos, Nigeria, twenty-two (22) teratospermic and thirty-five (35) oligospermic infertile men as well as thirty (35) normospermic fertile men (control) who volunteered and gave consent were recruited for the cross-section study after meeting the inclusion criteria and confirmation of their fertility statuses by the use of computer-Assisted Sperm Analyzer (CASA). Semen was collected from the participants under the WHO guideline for semen collection and processing. Spermatozoa’s DNA was extracted with the use of Proteinase K Storage Buffer. Nanodrop 1000 spectrophotometer was used to quantify the isolated genomic DNA. PRM II F: 5-AGGGCCCTGCTAGTTGTGA-3' and PRM II R: 3'- CAGATCTTGTGGGCTTCTCG -5, were used as primers. Sequencing of sperm DNA was done using the BigDye Terminator kit on a 3510 ABI sequencer by Inqaba Biotechnological, Pretoria South Africa. Agarose gel electrophoresis was used to show the amplified PRM2. In the study, 7 SNPs in the teratospermic infertile men, 8 SNPs in the oligospermic infertile men and 7 SNPs in the normospermic fertile men were discovered. The SNPs between the teratospermic infertile men and the oligospermic infertile men are significantly different. We propose that considerably larger genome-wide investigations are required to confidently validate these SNPs and find new SNPs linked with male infertility.
 
Protamine 2 gene; Single nucleotide polymorphisms; Teratospermic; Oligospermic; Infertile
 
https://wjarr.com/sites/default/files/fulltext_pdf/WJARR-2024-2164.pdf

Preview Article PDF

Emmanuel Sunday Oni, Ojo Moses Oke, Josephine Kpalap, Samuel Kehinde Wojuade, Adewale Oke and Emmanuel Ayomide Oni. Evaluation of protamine 2 genes in spermatozoa of teratospermic and oligospermic men in Nigeria. World Journal of Advanced Research and Reviews, 2024, 23(1), 2235-2242. Article DOI: https://doi.org/10.30574/wjarr.2024.23.1.2164

Copyright © Author(s). All rights reserved. This article is published under the terms of the Creative Commons Attribution 4.0 International License (CC BY 4.0), which permits use, sharing, adaptation, distribution, and reproduction in any medium or format, as long as appropriate credit is given to the original author(s) and source, a link to the license is provided, and any changes made are indicated.


All statements, opinions, and data contained in this publication are solely those of the individual author(s) and contributor(s). The journal, editors, reviewers, and publisher disclaim any responsibility or liability for the content, including accuracy, completeness, or any consequences arising from its use.

Get Certificates

Get Publication Certificate

Download LoA

Check Corssref DOI details

Issue details

Issue Cover Page

Editorial Board

Table of content

Copyright © 2026 World Journal of Advanced Research and Reviews - All rights reserved

Developed & Designed by VS Infosolution