Evaluation of protamine 2 genes in spermatozoa of teratospermic and oligospermic men in Nigeria
1 Department of Medical Laboratory Science, Joseph Ayo Babalola University, Ikeji-Arakeji, Osun State, Nigeria.
2 Department of Medical Laboratory Science, Rivers State University Port-Harcourt, Nigeria.
3 Department of Medical Laboratory Science, McPherson University, Lagos Ibadan Express way, Ibadan, Nigeria.
4 Abims Fertility and Andrology Clinic 25, Olowu Street, Off Awolowo way, Ikeja, Lagos.
Research Article
World Journal of Advanced Research and Reviews, 2024, 23(01), 2235–2242
Publication history:
Received on 08 June 2024; revised on 20 July 2024; accepted on 22 July 2024
Abstract:
There have been several reports of single nucleotide polymorphisms (SNPs) linked to different kinds of male infertility. The aim of the study was to evaluate single nucleotide polymorphisms in protamine 2 gene (PRM2) in spermatozoa of teratospermic and oligospermic infertile men in Nigeria. At some fertility clinics in Lagos, Nigeria, twenty-two (22) teratospermic and thirty-five (35) oligospermic infertile men as well as thirty (35) normospermic fertile men (control) who volunteered and gave consent were recruited for the cross-section study after meeting the inclusion criteria and confirmation of their fertility statuses by the use of computer-Assisted Sperm Analyzer (CASA). Semen was collected from the participants under the WHO guideline for semen collection and processing. Spermatozoa’s DNA was extracted with the use of Proteinase K Storage Buffer. Nanodrop 1000 spectrophotometer was used to quantify the isolated genomic DNA. PRM II F: 5-AGGGCCCTGCTAGTTGTGA-3' and PRM II R: 3'- CAGATCTTGTGGGCTTCTCG -5, were used as primers. Sequencing of sperm DNA was done using the BigDye Terminator kit on a 3510 ABI sequencer by Inqaba Biotechnological, Pretoria South Africa. Agarose gel electrophoresis was used to show the amplified PRM2. In the study, 7 SNPs in the teratospermic infertile men, 8 SNPs in the oligospermic infertile men and 7 SNPs in the normospermic fertile men were discovered. The SNPs between the teratospermic infertile men and the oligospermic infertile men are significantly different. We propose that considerably larger genome-wide investigations are required to confidently validate these SNPs and find new SNPs linked with male infertility.
Keywords:
Protamine 2 gene; Single nucleotide polymorphisms; Teratospermic; Oligospermic; Infertile
Full text article in PDF:
Copyright information:
Copyright © 2024 Author(s) retain the copyright of this article. This article is published under the terms of the Creative Commons Attribution Liscense 4.0